Subscribe to our newsletter
Qck Mouse Pads Review Boosh News (press release) (blog) When people ask for a mouse pad recommendation, the Steelseries QcK pads come up fairly often. I will begin my recommendation by trying to determine exactly ... |
Signature Suites at the Disneyland Hotel: Mickey Mouse Penthouse Chip and Co The Mickey Mouse Penthouse could be your ultimate Mouse Pad. I'm excited to show you around the place in today's post, the second in our series that ... |
Computer problem: scroll pad on laptop keeps turning off PocketFives.com (blog) But if i close the lid of the laptop then open it back up later the scroll on the mouse pad doesnt work. I have to click/hold and scroll the webpages. ... |
![]() CNET (blog) | Hands-on with the Toshiba Libretto W105-L251 CNET (blog) Tap the same button twice and you get a virtual onscreen touch pad instead. Our first struggle came with figuring out how to juggle these two virtual input ... |
Microsoft's Arc Touch Mouse Brings the Mouse Back In Style (NASDAQ: MSFT) American Consumer News (blog) However, many people prefer using a mouse, and even choose to use them over the touch pad on a laptop. The problem comes with the limited portability they ... |
There remain considerable challenges for the PC in the coming years, including large-scale computational problems that will require ever more robust ... (more)
There's no getting rid of mice, despite the acrobatics we often go through to use them, and the sore wrists and shoulders that they can cause. OZ E... (more)
Internet appliancesdevices designed for easy Internet access and navigationare all the rage. And hardware developers are bending over bac... (more)
The House of Doolittle specializes in making calendars, organizers, and other desk products from 30- and 100-percent post-consumer recycled materia... (more)
Surfing the Web just got a little easier. Now you can launch your favorite sites at the touch of a button, thanks to mysmart.com's "smart" mouse pa... (more)
SAN DIEGO -- MouseMattres.com has released MouseMattress, a foam mouse pad contoured to sit on a person's thigh to prevent and alleviate stretch an... (more)
Vaccination with DNA of the Mycobacterium tuberculosis 85B Antigen Protects Mouse Foot Pad Against Infection with M. leprae1 DNA vaccines are a new ... (more)
SAN JOSE, Calif. -- The Ergo Write Mouse Pad, launched by Solve-It! Marketing Co., is half mouse pad, half notepad -- allowing users to jot down me... (more)
In the same drawer we keep our 'People who have far too much time on their hands' file, we were hoping to try out a new product recently sent to us: ... (more)
I'm following several big stories, and if they develop punch lines, I'll be writing about them. There's the next version of OS/2 Warp, code-named Mer... (more)
BROSSARD, Que. -- Forminco has announced the Mouse Rink, an ergonomic mouse pad with a suggested retail price of less than $15. The Mouse Rink's pate... (more)
There remain considerable challenges for the PC in the coming years, including large-scale computational problems that will require ever more robust ... (more)
There's no getting rid of mice, despite the acrobatics we often go through to use them, and the sore wrists and shoulders that they can cause. OZ E... (more)
Internet appliancesdevices designed for easy Internet access and navigationare all the rage. And hardware developers are bending over bac... (more)
The House of Doolittle specializes in making calendars, organizers, and other desk products from 30- and 100-percent post-consumer recycled materia... (more)
Surfing the Web just got a little easier. Now you can launch your favorite sites at the touch of a button, thanks to mysmart.com's "smart" mouse pa... (more)
SAN DIEGO -- MouseMattres.com has released MouseMattress, a foam mouse pad contoured to sit on a person's thigh to prevent and alleviate stretch an... (more)
No more sore wrist with Kensington's Expert Mouse Pro Wireless. This trackball pad can be positioned any where on your desktop, and it supports you... (more)
I'm following several big stories, and if they develop punch lines, I'll be writing about them. There's the next version of OS/2 Warp, code-named Mer... (more)
Vaccination with DNA of the Mycobacterium tuberculosis 85B Antigen Protects Mouse Foot Pad Against Infection with M. leprae1 DNA vaccines are a new ... (more)
Piles of games on the floor. Holes in my socks. And I’m all alone—so alone! Life is miserable because I don’t have a cool computer ... (more)
Vaccination with DNA of the Mycobacterium tuberculosis 85B Antigen Protects Mouse Foot Pad Against Infection with M. leprae1
DNA vaccines are a new approach to vaccination. Plasmids containing genes from a variety of pathogens have been used to induce protection from a variety of bacterial, viral, a protozoal and helminth infections in animal models (7). In mouse models of tuberculosis (TB) and Mycobacterium avium infection, plasmid vaccination has shown an equivalent protective efficacy equal to that of BCG against virulent mycobacterial infection.
The mouse foot pad model of leprosy infection has been used to measure the vaccine potential of various candidate leprosy vaccines over the past 30 years. In this model, a limited self-healing infection is prevented by BCG, live and heat-killed M. leprae (20), various mycobacterial species (21), and leprosy fractions (14, 16). This model is the only practicable method for assessing new vaccines for leprosy or for assessing new tuberculosis vaccines for possible cross-protection against leprosy. The mycobacterial antigen 85 (Ag85) family is a group of three closely related proteins that are secreted, bind to fibronectin and are highly conserved across mycobacterial species (17). Vaccination with the 85B gene protects against tuberculosis infection in the mouse (9). It has been previously demonstrated that immunization of mice with Ag85B DNA was able to elicit a strong immune response. High titers of anti-85B-- specific antibody and antigen-specific cytotoxic T cells were generated by Ag85B DNA immunization, while antigen-specific T-cell proliferation was characterized by the production of interferon-gamma (IFN-gamma) and not interleukin-4 (IL-4) (9). The ability of Ag85B DNA to protect against challenge with M. leprae was investigated since vaccination with this vector had protected mice against virulent M. tuberculosis infection (9).
MATERIALS AND METHODS
Production of DNA vaccines. The Ag85B gene was amplified from the M. tuberculosis genome using the ag85b specific primers 5', GTCCGAAGCTTATGACAGACGTGACGGGA and 3' TAATAGGATCCTCAGCCGGCGCCTAACGA, and cloned into the vector pJW4303, as previously described (9). The expression of the gene was driven by the cytomegalovirus immediate early promoter with intron A. For immunization, the vector was purified using caesium chloride ultracentrifugation (18) and resuspended in phosphate buffered saline (PBS) at 1 mg/ml. The parental vector pJW4303 was used as the negative control.
Immunization of animals. Swiss albino outbred mice were immunized three times intramuscularly in both hind flanks at 3 weekly intervals with DNA (100 (mu)g per injection). Control mice were immunized three times with PBS or once with 10^sup 6^ of live BCG vaccine intradermally.
Four weeks after the last injections, mice were infected in both hind foot pads with 10^sup 4^ M. leprae in a 30 (mu)l volume. Unvaccinated mice were inoculated with the same strain to measure the growth of the organisms over 4 to 8 months. Two complete experiments were performed with two strains of M. leprae.
Measurement of M. leprae growth. Foot pads were harvested 6 months after infection with M. leprae and each month thereafter until a growth of 1.5 logs over the inoculum in control mice was reached. The number of bacilli in each foot pad was enumerated by homogenizing the foot pad in 0.1% bovine serum albumin (BSA) in PBS and smearing a calibrated loopful over a slide in an area 8 mm in diameter. The slides were stained by the Ziehl-Nielsen technique. The number of acid-fast bacilli (AFB) in eight 100x oil objective fields was counted and the number of AFB per foot pad was calculated by multiplying the count by the loop volume (19). The lower level of detection was 10,000 AFB.
RESULTS
Results of the two experiments are shown in Table 1 and in The Figure. Vaccination with control plasmid DNA did not inhibit the growth of M. leprae in the mouse foot pad. By contrast, growth was strongly inhibited in the foot pads of mice vaccinated with either Ag85B DNA or with live BCG. The mean/median AFB counts for each group are shown in Table 1, and show a significant reduction of 61%-88% in bacterial growth. Vaccination with Ag85B DNA was less than the protective efficacy of BCG in the same experiments.
DISCUSSION
DNA vaccines consist of a circular plasmid with a number of important characteristics which influence the immune potency of the vaccines. The gene of interest is under the control of a strong promoter which drives expression of the protein in host cells. Plasmids persist in muscle cells for long periods and provide a strong, sustained stimulus to the immune system. DNA vaccines containing unmethylated CpG dinucleotides within the plasmid are potent adjuvants. DNA vaccines cause polyclonal activation of B cells, macrophages, dendritic cells and a T-helper-1 immune response characterized by cytotoxic T cells and high levels of IFN-gamma-producing T cells (10, 26). These kinds of immune responses are important in protection from mycobacterial diseases, including leprosy.
This is the second demonstration of a protective effect of DNA vaccines in the mouse foot pad model of leprosy infection. The first demonstration, also from this laboratory (13), used the gene for the 35-kDa protein in a similar plasmid. The use of the present plasmid has demonstrated that the use of the Ag85B plasmid vaccine has a bidirectional protective efficacy against leprosy and tuberculosis (9). The protection from leprosy infection is equivalent to that obtained by BCG. Our results are in contrast with those of Gillis, et al. (4) who found that vaccination with the closely related Ag85A DNA gave only marginal protection against M. leprae infection in the foot pads of BALB/c mice. The same Ag85A DNA vaccine, however, protected C57/B6 mice against infection with M. tuberculosis (8).
Two reports of DNA vaccines using M. leprae genes to protect against tuberculosis have been published. The MLhsp65 in a transfected macrophage line (22) and as DNA (25) protected against TB challenge. Protection was also achieved with DNA vaccines containing the gene for the M. leprae 36-kDa protein (25). Although hsp65 protein in Freund's complete adjuvant (FCA) protects the mouse foot pad against leprosy infection (6), neither of the DNA vaccines have to our knowledge been tested against leprosy in the mouse foot pad model.
In murine models of tuberculosis infection, a number of DNA vaccines have been tested for protective efficacy. DNA vaccines containing M. tuberculosis genes for the 38-kDa (27), PstS-3 (24), and MTB39A (2) have a protective effect against virulent tuberculosis challenge. However, not all anti-TB DNA vaccines are effective. Vaccines containing genes for the M. tuberculosis 19-kDa lipoprotein (3) and Ag85C (12) fail to provoke T-cell responses to the respective proteins, while vaccination with the DNA of the PstS-1 protein generates a cellular immune response but not protection against virulent challenge (24). Recent work has demonstrated a consistent hierarchy in protective efficacy among DNA vaccines made with three TB protein genes. The present construct was shown to be more effective than vaccines containing the ESAT6 gene which, in turn, was more effective than vaccines containing the MPT64 gene (9). Interestingly, a recent report has shown that DNA vaccines in mouse models of tuberculosis can also have a therapeutic effect, stimulating immune responses in infected animals which can cause the clearance of bacteria from the lungs (11).

