Search funkymousepads.com

Subscribe to our newsletter

 

Latest News


CNET News

Asus reads beyond netbook at CES
EETimes.com - 5 hours ago
Asus also showed a notebook that used a 4.3-inch touch-screen display in place of a mouse pad. An ARM processor ran software widgets on the touch display ...
Asus Shows a Tablet-Style Eee PC Wired News
CES 2009: Asus shows touchscreen EeePC and Keyboard PC TG Daily
Asus shows off Eee Keyboard with 5in display Fudzilla
eFluxMedia - AsiaOne
all 108 news articles

Slippery Brick

Logitech announces handful of G-Series PC gaming accessories
CNET News, CA - 15 hours ago
Alarmingly, the press release mentions no combustion threshold data, so we can't comment as to whether or not the G9x will burn through your mouse pad and ...
Logitech Wins Seven CES Innovation Awards WELT ONLINE
Logitech shows off its revamped gaming lineup - two keyboards a ... Tech Digest
CES 2009: Logitech Announces New G-series Peripherals for PC Gaming Gearlog
I4U
all 78 news articles

PC World

HTC S743 Smart Phone Is Sleek but Pricey
PC World - 18 hours ago
This ultraslim smart phone (4.6 by 1.7 by 0.6 inches, 4.9 ounces) features a 12-key number pad and a slide-out full QWERTY keyboard. ...
Meet HTC?s Latest Smartphone: The S743 LAPTOP Magazine
HTC Releases Its New S743 Phone eFluxMedia
HTC S740 review TechRadar UK
PhoneNews.com - TechWhack
all 61 news articles

Nova Killer 2 Mousepad Review
Jonny Guru, FL - Jan 5, 2009
A mousepad. But not just any mousepad, a gigantic mousepad that would ensure I would never have extra room on my desk again. And that mousepad is non other ...

Review: Razer Destructor Mousepad
Cornell University The Cornell Daily Sun, NY - Dec 22, 2008
By Zheng Gu Most gamers don't think of their mouse pad as a key ingredient for success. Hardcore gamers know better, though. The Destructor is a firm pad ...
Search for:  

 

Rug Mouse Pad
ich, in turn, was more effective than vaccines containing the MPT64 gene (9). Interestingly, a recen...
rug-mouse-pad.php

Mouse Pad Diablo
), PstS-3 (24), and MTB39A (2) have a protective effect against virulent tuberculosis challenge. How...
mouse-pad-diablo.php

Free Computer Mouse Pad
5', GTCCGAAGCTTATGACAGACGTGACGGGA and 3' TAATAGGATCCTCAGCCGGCGCCTAACGA, and cloned into the vector p...
free-computer-mouse-pad.php

Make Your Own Mouse Pad
osphate buffered saline (PBS) at 1 mg/ml. The parental vector pJW4303 was used as the negative contr...
make-your-own-mouse-pad.php

Mouse Pad Printing
in Table 1 and in The Figure. Vaccination with control plasmid DNA did not inhibit the growth of M. ...
mouse-pad-printing.php

Photo Frame Mouse Pad
ffered saline (PBS) at 1 mg/ml. The parental vector pJW4303 was used as the negative control. Immun...
photo-frame-mouse-pad.php

Diablo 2 Mouse Pad Maphack
d by Ag85B DNA immunization, while antigen-specific T-cell proliferation was characterized by the pr...
diablo-2-mouse-pad-maphack.php

Unique Mouse Pad
th M. leprae was investigated since vaccination with this vector had protected mice against virulent...
unique-mouse-pad.php

1.11 2 Diablo Mouse Pad
of a strong promoter which drives expression of the protein in host cells. Plasmids persist in muscl...
1.11-2-diablo-mouse-pad.php

Advertising Mouse Pad
st cells. Plasmids persist in muscle cells for long periods and provide a strong, sustained stimulus...
advertising-mouse-pad.php

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Next » 



Vaccination with DNA of the Mycobacterium tuberculosis 85B Antigen Protects Mouse Foot Pad Against Infection with M. leprae1

DNA vaccines are a new approach to vaccination. Plasmids containing genes from a variety of pathogens have been used to induce protection from a variety of bacterial, viral, a protozoal and helminth infections in animal models (7). In mouse models of tuberculosis (TB) and Mycobacterium avium infection, plasmid vaccination has shown an equivalent protective efficacy equal to that of BCG against virulent mycobacterial infection.

The mouse foot pad model of leprosy infection has been used to measure the vaccine potential of various candidate leprosy vaccines over the past 30 years. In this model, a limited self-healing infection is prevented by BCG, live and heat-killed M. leprae (20), various mycobacterial species (21), and leprosy fractions (14, 16). This model is the only practicable method for assessing new vaccines for leprosy or for assessing new tuberculosis vaccines for possible cross-protection against leprosy. The mycobacterial antigen 85 (Ag85) family is a group of three closely related proteins that are secreted, bind to fibronectin and are highly conserved across mycobacterial species (17). Vaccination with the 85B gene protects against tuberculosis infection in the mouse (9). It has been previously demonstrated that immunization of mice with Ag85B DNA was able to elicit a strong immune response. High titers of anti-85B-- specific antibody and antigen-specific cytotoxic T cells were generated by Ag85B DNA immunization, while antigen-specific T-cell proliferation was characterized by the production of interferon-gamma (IFN-gamma) and not interleukin-4 (IL-4) (9). The ability of Ag85B DNA to protect against challenge with M. leprae was investigated since vaccination with this vector had protected mice against virulent M. tuberculosis infection (9).

MATERIALS AND METHODS

Production of DNA vaccines. The Ag85B gene was amplified from the M. tuberculosis genome using the ag85b specific primers 5', GTCCGAAGCTTATGACAGACGTGACGGGA and 3' TAATAGGATCCTCAGCCGGCGCCTAACGA, and cloned into the vector pJW4303, as previously described (9). The expression of the gene was driven by the cytomegalovirus immediate early promoter with intron A. For immunization, the vector was purified using caesium chloride ultracentrifugation (18) and resuspended in phosphate buffered saline (PBS) at 1 mg/ml. The parental vector pJW4303 was used as the negative control.

Immunization of animals. Swiss albino outbred mice were immunized three times intramuscularly in both hind flanks at 3 weekly intervals with DNA (100 (mu)g per injection). Control mice were immunized three times with PBS or once with 10^sup 6^ of live BCG vaccine intradermally.

Four weeks after the last injections, mice were infected in both hind foot pads with 10^sup 4^ M. leprae in a 30 (mu)l volume. Unvaccinated mice were inoculated with the same strain to measure the growth of the organisms over 4 to 8 months. Two complete experiments were performed with two strains of M. leprae.

Measurement of M. leprae growth. Foot pads were harvested 6 months after infection with M. leprae and each month thereafter until a growth of 1.5 logs over the inoculum in control mice was reached. The number of bacilli in each foot pad was enumerated by homogenizing the foot pad in 0.1% bovine serum albumin (BSA) in PBS and smearing a calibrated loopful over a slide in an area 8 mm in diameter. The slides were stained by the Ziehl-Nielsen technique. The number of acid-fast bacilli (AFB) in eight 100x oil objective fields was counted and the number of AFB per foot pad was calculated by multiplying the count by the loop volume (19). The lower level of detection was 10,000 AFB.

RESULTS

Results of the two experiments are shown in Table 1 and in The Figure. Vaccination with control plasmid DNA did not inhibit the growth of M. leprae in the mouse foot pad. By contrast, growth was strongly inhibited in the foot pads of mice vaccinated with either Ag85B DNA or with live BCG. The mean/median AFB counts for each group are shown in Table 1, and show a significant reduction of 61%-88% in bacterial growth. Vaccination with Ag85B DNA was less than the protective efficacy of BCG in the same experiments.

DISCUSSION

DNA vaccines consist of a circular plasmid with a number of important characteristics which influence the immune potency of the vaccines. The gene of interest is under the control of a strong promoter which drives expression of the protein in host cells. Plasmids persist in muscle cells for long periods and provide a strong, sustained stimulus to the immune system. DNA vaccines containing unmethylated CpG dinucleotides within the plasmid are potent adjuvants. DNA vaccines cause polyclonal activation of B cells, macrophages, dendritic cells and a T-helper-1 immune response characterized by cytotoxic T cells and high levels of IFN-gamma-producing T cells (10, 26). These kinds of immune responses are important in protection from mycobacterial diseases, including leprosy.

This is the second demonstration of a protective effect of DNA vaccines in the mouse foot pad model of leprosy infection. The first demonstration, also from this laboratory (13), used the gene for the 35-kDa protein in a similar plasmid. The use of the present plasmid has demonstrated that the use of the Ag85B plasmid vaccine has a bidirectional protective efficacy against leprosy and tuberculosis (9). The protection from leprosy infection is equivalent to that obtained by BCG. Our results are in contrast with those of Gillis, et al. (4) who found that vaccination with the closely related Ag85A DNA gave only marginal protection against M. leprae infection in the foot pads of BALB/c mice. The same Ag85A DNA vaccine, however, protected C57/B6 mice against infection with M. tuberculosis (8).

Two reports of DNA vaccines using M. leprae genes to protect against tuberculosis have been published. The MLhsp65 in a transfected macrophage line (22) and as DNA (25) protected against TB challenge. Protection was also achieved with DNA vaccines containing the gene for the M. leprae 36-kDa protein (25). Although hsp65 protein in Freund's complete adjuvant (FCA) protects the mouse foot pad against leprosy infection (6), neither of the DNA vaccines have to our knowledge been tested against leprosy in the mouse foot pad model.

In murine models of tuberculosis infection, a number of DNA vaccines have been tested for protective efficacy. DNA vaccines containing M. tuberculosis genes for the 38-kDa (27), PstS-3 (24), and MTB39A (2) have a protective effect against virulent tuberculosis challenge. However, not all anti-TB DNA vaccines are effective. Vaccines containing genes for the M. tuberculosis 19-kDa lipoprotein (3) and Ag85C (12) fail to provoke T-cell responses to the respective proteins, while vaccination with the DNA of the PstS-1 protein generates a cellular immune response but not protection against virulent challenge (24). Recent work has demonstrated a consistent hierarchy in protective efficacy among DNA vaccines made with three TB protein genes. The present construct was shown to be more effective than vaccines containing the ESAT6 gene which, in turn, was more effective than vaccines containing the MPT64 gene (9). Interestingly, a recent report has shown that DNA vaccines in mouse models of tuberculosis can also have a therapeutic effect, stimulating immune responses in infected animals which can cause the clearance of bacteria from the lungs (11).

 1 -  2 -  3 -  Next 
Copyright funkymousepads.com 2005